The National Policy Framework on Agricultural Marketing drafted by the Agriculture Ministry, has been circulated for public comments and suggestions.

Background

• Repeal of the Farm Laws: The Government tried to usher in agriculture reforms by bringing in three farm laws during the Covid pandemic but had to repeal them eventually, in the face of farmers’ protests.
• Jurisdiction: Agriculture is a State subject whereas, Agricultural trade comes under the concurrent list.

Enroll now for UPSC Online Course

Key Proposals in the Draft National Policy Framework on Agricultural Marketing

• Constitution of an Empowered Agricultural Marketing Reform Committee
  • Suggested creation of a panel similar to the GST Empowered Committee of State Finance Ministers.
  • Composition: State agriculture ministers, chaired on a rotational basis.
  • Registration: Under the Societies Registration Act, 1860.
  • Constitution of the Committee: The constitution of the committee should be made through non-statutory gazette notification.
  • Operation: Quarterly meetings or as needed; a permanent secretariat proposed.
• Goals of the Committee
  • To push the states to adopt the reform provisions in the state APMC Acts, 
  • Notify the rules and also build up the consensus among the states to move towards a unified national market for agricultural produce through a single licensing/registration system and single fee.
• Proposed Reforms for States: 
  • Adoption of the Model Agricultural Produce Marketing Act, 2003.
  • Implementation of 12 identified reform areas, including:
    • Private wholesale markets.
    • Direct farm-gate purchases by processors, exporters, and retailers.
    • Deemed market yard status for warehouses and cold storages.
    • Single-time market fee and unified trading license across states.
• Price Insurance Scheme for Farmers: Proposed a price assurance mechanism similar to PM Fasal Bima Yojana (PMFBY) with an aim to:
  • Stabilise farmer incomes during price crashes.
  • Encourage adoption of modern agricultural practices.
  • Enhance credit flow to the agriculture sector.

Significance of the Proposed Draft Policy

• Addressing Market Fragmentation: The Proposals tries to address fragmentation of markets within the state in the name of notified market area managed and regulated by statutorily constituted market committee due to state-legislated APMC Acts.
• Bridging Divergence of Views: Seeks to resolve divergence of views between the Centre, states, and farmers on agricultural marketing.

About Agricultural Marketing

• Agricultural marketing involves all activities related to the movement of agricultural produce from farms to consumers. 
  • This includes collection, grading, storage, transportation, processing, and sale.
• Agricultural Marketing In India is governed by the Agricultural Produce Marketing Committee (APMC) Acts, which are administered by respective State Governments.

Check Out UPSC CSE Books From PW Store

Reasons For Increasing Importance of Agricultural Marketing

• Increase in Marketable Surplus: Improved technology and better-quality seeds have led to increased agricultural productivity, resulting in a higher surplus of commodities. 
  • Efficient and responsive markets are necessary to handle this surplus.
• Market Requirements for Horticultural Crops: Diversification toward high-value horticultural crops, which are bulky and perishable, requires proper handling and storage to maintain quality throughout the supply chain.
• Price Discovery and Price Signals: Agricultural marketing involves discovering prices at different stages and transmitting price signals, especially from consumers to farmers.
  • Price signals help the farmers understand market trends and make informed decisions on what to grow, when to sell, and at what price, ensuring fair pricing and aligning production with demand.
• Feeding Urban Populations: Increased urbanisation requires efficient agricultural marketing systems to transport food from rural areas to urban centers, meeting the growing demand for food in cities.

Problem Areas in Agricultural Marketing in India

• Fragmented Market Structure: Agricultural markets in India are governed by state-specific Agricultural Produce Market Committee (APMC) Acts, which fragment the marketing system.
  • There are around 2,500 APMC-regulated wholesale markets across the country.
  • Farmers are often required to sell their produce at designated APMC mandis, limiting their access to a wider market.
• Regulatory Bottlenecks: High market fees, cess charges, and licensing requirements increase transaction costs.
  • Different states have varying regulations, hindering the development of a unified national market.
• APMC Problems: The APMC system in India faces issues such as limited number of traders in APMC markets thereby reducing competition, cartelisation of traders, and undue deductions in the form of commission charges and market fee. 
  • Example: In Haryana and Punjab, mandi fees and rural development charges for wheat and non-basmati rice purchased by FCI are four to six times the charges for basmati rice purchased by private players. 
• Small and Scattered Holdings: Fragmented landholdings increase production and transportation costs, reducing marketing margins.
  • As of 2022, there were 121 million agricultural holdings in India; out of these 99 million holdings are small and marginal (87%). 
• Inadequate Storage Facilities: Lack of proper storage, including cold storage, forces farmers to sell produce immediately, often at low prices. 
  • Most of the existing storage facilities are in very poor condition which affects the quality of the agricultural produce and leads to post harvest losses.
    • Example: The All-India post-harvest loss survey by NABCONS, 2022, reveals that the country suffers staggering food losses worth Rs 1.53 trillion ($18.5 billion) with a loss of 12.5 million metric tons (MMT) of cereals, 2.11 MMT of oilseeds and 1.37 MMT of pulses.
• Poor Transportation Infrastructure: Absence of all-weather roads, suitable vehicles for perishables, and linkage roads to mandis escalates transportation costs.
• Limited Access to Credit: Farmers rely on high-interest loans from moneylenders due to limited access to affordable institutional credit, pushing them to sell produce prematurely to repay debts.
  • Example: Only 30% of all farmers borrow from formal sources, while nearly 50% of small and marginal farmers are unable to borrow from any source
• Lack of Market Information: Inadequate infrastructure and limited ICT access in rural areas leave farmers unaware of market prices, making them dependent on middlemen.
• Insufficient Marketing Research: Emphasis on production over research in marketing, storage, and packaging results in outdated techniques and insufficient understanding of consumer preferences.
• Absence of Farmers’ Organisations: Farmers operate individually, increasing costs and reducing bargaining power, leading to exploitation by organised traders.
  • Farmers often do not get remunerative prices for their produce
    • Example: Individual dairy farmers selling milk might receive lower prices compared to members of cooperative societies like Amul, which negotiate better rates and provide storage support.

Check Out UPSC Modules From PW Store

Government Measures to Improve Agricultural Marketing In India

• Launch of National Agriculture Market (e-NAM): In 2016, the government launched e-NAM, enabling farmers to sell their produce transparently to a larger number of buyers across multiple markets electronically.
• Formation and Promotion of Farmer Producer Organizations (FPOs): The Government of India has approved and launched a Central Sector Scheme of “Formation and Promotion of 10,000 Farmer Producer Organizations (FPOs)” to form and promote 10,000 new FPOs till 2027-28.

• Agriculture Infrastructure Fund (AIF): The government has set up the Agriculture Infrastructure Fund (AIF) with an allocation of Rs. 1,00,000 crore to support post-harvest infrastructure projects such as warehousing and community farming assets through interest subvention and financial aid.
• Agricultural Marketing Infrastructure (AMI) Scheme: Under the Integrated Scheme for Agricultural Marketing (ISAM), the government supports the construction of godowns and warehouses in rural areas, enhancing storage capacity. 
  • Subsidies of 25% to 33.33% on project capital costs are provided based on the beneficiary’s category.
• Establishment of Private Markets: Over 120 private markets have been established, providing farmers with alternative marketing channels and ensuring better prices for their produce.
• Model Contract Farming Act, 2018: Excludes contract farming from the jurisdiction of Agricultural Produce Marketing Committees (APMCs).
  • Includes provisions for dispute resolution, such as negotiation, reconciliation, and referral to a dispute settlement officer.
• Model Agricultural Produce and Livestock Marketing (Promotion and Facilitating) Act, 2017 (APLM)
  • Replaces the APMC Act, 2003, to create a unified agricultural market with a single license for both agriculture produce and livestock.
  • Mandates the establishment of regulated wholesale agri-markets every 80 km.
  • Allows private market yards, warehouses, and cold storages to function as regulated agri-markets.
• Operation Greens: Aims to stabilize the supply of Tomato, Onion, and Potato (TOP) crops to reduce price volatility of these crops.

Enroll now for UPSC Online Classes

Way Forward

• Effective Implementation of Economic Survey Suggestions: The Economic Survey of 2024 indicated that implementing the e-National Agriculture Market (e-NAM), supporting Farmers Producer Organisations (FPOs), and enabling cooperatives to participate in agri-marketing could enhance market infrastructure and facilitate better price discovery.
• Financial incentives to states: NITI Aayog has revived the 15th Finance Commission’s idea of providing financial incentives to states to encourage them to implement agriculture reforms.
  • The Finance Commission had recommended performance-based incentives for the implementation of agrarian reforms by the states.
• e-NAM Reforms
  • Implement a unified e-NAM trading license across all APMCs to simplify the process for traders and eliminate the need for separate licenses. 
  • Expand e-NAM coverage by integrating more APMCs into the platform, enhancing regional connectivity, and providing farmers access to a larger pool of buyers for better price discovery.
  • Encourage more farmers to sell their produce directly through e-NAM rather than relying on intermediaries
• Enable Sample-Based Sales: Allow farmers to bring a sample of their produce to the mandi, along with relevant quality certification, instead of hauling the entire lot. 
  • This would save on transportation costs and reduce crowding at APMCs, while benefiting traders by receiving graded produce ready for transportation.
• Storage and Banking Facilities Near APMCs: Provide bagging and storage facilities near APMCs along with loans against warehouse receipts to avoid distress sales during the post-harvest months. 

Conclusion

• As Agriculture is a state subject, its implementation of reforms faces challenges. 
• There is a need to build consensus between the Centre, states, and farmers and incorporate the principles of Cooperative Federalism for improving the agricultural Ecosystem of our Country.

DOWNLOAD PDF

To achieve its 2047 development goals, India emphasizes science, technology, and research security to harness innovation while addressing global competitiveness and emerging threats.

Role of Science and Technology in India’s Development by 2047

• India aims to achieve significant development by 2047 with an emphasis on science and technology (S&T) in strategic and emerging sectors.
• Investment in cutting-edge technologies is crucial to:
  • Stay globally competitive.
  • Address societal challenges.
  • Unlock economic opportunities.

Enroll now for UPSC Online Course

Importance of Research Security

• Definition: Safeguarding scientific research from threats to confidentiality, economic value, and national interest.
• Research security protects the:
  • Means, know-how, and products of research
  • Scientific research inputs
  • Processes
  • Outcomes 
• It’s important for: 
  • Protecting public investment in research 
  • Preventing the misuse of research data and technology 
  • Protecting the safety and security of students and employees traveling abroad 
  • Safeguarding against foreign government interference 
  • Minimizing risks and maximizing rewards of collaborative science
• Threats in the Geopolitical Context:
  • Foreign Interference: Influence or manipulation by foreign entities to compromise national research interests.
    • Example: According to U.S. intelligence, the Russian government conducted foreign electoral interference in the 2016 United States elections with the goal of boosting the presidential campaign of Donald Trump.
  • Intellectual Property Theft: Stealing proprietary knowledge or technologies to gain economic or strategic advantage.
    • Example: In late 2020, North Korean cyber attackers reportedly targeted the vaccine maker AstraZeneca in the UK.
  • Insider Threats: Individuals within organizations compromising research security, intentionally or unintentionally.
    • Example: A Harvard professor arrested in 2020 for undisclosed ties to Chinese funding while receiving US defense grants.
  • Cyberattacks: Hacking attempts to sabotage or steal sensitive research data and disrupt critical infrastructure.
    • Example: In 2021, a ransomware attack on the Colonial Pipeline caused widespread fuel shortages on the East Coast of the United States.
  • Unauthorized Access to Sensitive Data: Breaches exposing confidential research, harming national security and competitiveness.
    • Example: In 2018, the University of California, Berkeley experienced a data breach affecting personal information of over 300,000 individuals, including faculty, staff, and students.

Global Precedents on Research Security

• USA:
  • CHIPS and Science Act with research security provisions.
  • National Security Presidential Memorandum 33 (NSPM-33) by the National Institute of Standards and Technology (NIST).
    • Published in January 2021, NSPM-33 directs federal agencies to strengthen protections against foreign government interference in US government-supported research and development.
• Canada:
  • National Security Guidelines for Research Partnerships.
    • In February 2023, three Canadian government ministers released a joint statement that bans government funding for research in sensitive areas if researchers are affiliated with certain foreign entities.
• European Union:
  • Risk appraisal
    • Before signing a partnership agreement, research and innovation organizations can perform a risk appraisal to consider the motivations and agendas of international partners.
  • Emphasis on sector self-governance and risk-based approaches.
  • Horizon Europe guidelines for research security.

Check Out UPSC NCERT Textbooks From PW Store

Challenges in Research Security

• Conflict with the Collaborative Nature of Science: Restrictions to safeguard research can hinder international collaborations critical to scientific advancements.
  • The Human Genome Project, a massive international collaboration, required open sharing of data and resources to accelerate scientific progress. Imposing strict security measures could have hindered such collaborative efforts.
• Balancing Open Science and Security: Ensuring transparency and accessibility in research while safeguarding sensitive information.
  • During COVID 19, rapid sharing of research data was crucial for vaccine development, concerns about intellectual property rights and misuse of sensitive information led to debates about data sharing restrictions.
• Increased Administrative Burden: Implementing research security measures increases the complexity of compliance for universities and researchers.
  • Regulatory obligations like the UK’s National Security and Investment Act and Canada’s National Security Guidelines for Research Partnerships require universities to dedicate significant resources to compliance.
• Risk of Political Interference: Security measures could become a tool for political influence, undermining academic freedom.
  • In some countries, research security measures have been used to suppress dissent or stifle critical research.
• Cost of Implementation: Establishing robust research security infrastructure is resource-intensive.
  • Tools like Dimensions Research Security, while effective in addressing risks, require financial investments that many institutions might struggle to afford.
• Dynamic and Evolving Threats: Rapid advancements in AI and other technologies make threats more unpredictable and complex.
  • The rapid evolution of cyber threats, such as ransomware attacks and data breaches, necessitates constant vigilance and adaptation of security measures.
• International Conflicts and Rivalries: Geopolitical tensions add complexity to managing research security across borders.
  • For instance, the US-China trade war has impacted scientific collaborations between the two countries, hindering joint research projects.
• Potential Over-Regulation: Overly stringent security measures can stifle innovation.
  • Regulations that fail to differentiate between routine research and high-risk areas could discourage researchers from exploring cutting-edge topics, as noted in discussions around AI governance.
• Integration with Research Ecosystem: Security protocols must align with research workflows without disrupting core activities.
  • For instance, strict data access controls may make it difficult for researchers to collaborate effectively.
• Emerging AI Risks: AI introduces ethical dilemmas, such as the potential misuse of algorithms and data.
  • AI’s ability to fabricate content complicates trust in research outputs. 
  • It also poses risks, like the use of machine learning models in developing unauthorized applications (e.g., deepfake technologies).

Check Out UPSC Modules From PW Store

Steps to Promote Research Security in India

• Formulate a National Research Security Policy: Develop a comprehensive framework to safeguard sensitive data, intellectual property, and strategic technologies like AI, quantum computing, and biotechnology.
  • Canada’s National Security Guidelines for Research Partnerships can serve as inspiration for India.
• Strengthen Cybersecurity Infrastructure: Invest in advanced cybersecurity systems to prevent cyberattacks and secure research infrastructure. Collaborate with national cybersecurity agencies for real-time threat detection and mitigation.
  • The European Space Agency enhanced its cybersecurity measures after targeted cyberattacks on sensitive projects.
• Classify and Prioritize Strategic Research: Categorize research projects based on their strategic importance and apply proportionate security measures to minimize over-regulation.
  • The US National Science Foundation classifies research areas to allocate security resources effectively.
• Promote Awareness and Training: Organize workshops, training, and educational modules for researchers on secure research practices and risk mitigation.
  • Universities in the UK, such as the University of Bristol, incorporate secure research training in their curriculum. Enhance Transparency in Foreign Collaborations: Require researchers to disclose foreign funding and collaborations, particularly in sensitive areas, to identify potential risks.

• • The US NSPM-33 Implementation Guidance mandates full disclosure of foreign partnerships to safeguard research.
• Establish a Dedicated Research Security Office: Create a specialized office under the Anusandhan National Research Foundation (ANRF) to coordinate and oversee research security measures across institutions.
  • The US NSF’s Research Security Office serves as a model for such an initiative.
• Adopt Ethical Standards for AI Research: Develop ethical norms and accountability guidelines for AI research to prevent misuse and ensure compliance with regulatory frameworks.
  • The AI Research Centre at City, University of London emphasizes the ethical responsibility of researchers.
• Allocate Funding and Foster International Collaboration: Provide financial support for secure research infrastructure and training while collaborating with trusted international partners to share expertise and best practices.
  • India’s collaborations within the Quad (US, Japan, Australia) could focus on research security in emerging technologies.

Enroll now for UPSC Online Classes

Conclusion

Ensuring robust research security is essential for safeguarding India’s strategic interests, fostering innovation, and achieving its development objectives by 2047. By balancing security with openness and collaboration, India can build a resilient and globally competitive research ecosystem.

DOWNLOAD PDF

Farmers from over 20 districts in Uttar Pradesh to protest against issues related to land acquisition and agricultural reforms.

Key Highlights of the Protest

• The protest was led by Bhartiya Kisan Parishad (BKP) in coordination with other farmer groups, including Kisan Mazdoor Morcha (KMM) and Samyukt Kisan Morcha (SKM).
• Main Demands:
  • Legal guarantee for Minimum Support Price (MSP).
  • 10% allocation of developed plots to farmers who lost their land.
  • Increased compensation (64.7%) for land acquisition, especially for those who have yet to receive it.
  • Implementation of the Land Acquisition Act, passed in 2013.

Enroll now for UPSC Online Course

About Minimum Support Price

• Definition of MSP: The Minimum Support Price (MSP) is a market intervention mechanism established by the Government of India to protect agricultural producers against a sharp decline in crop prices, especially during bumper production years.
• Legal Status: MSP does not have statutory backing in law, meaning it is not legally binding.
• Announcement Authority: MSP is announced by the Cabinet Committee on Economic Affairs (CCEA), which is chaired by the Prime Minister of India.
• • The announcement is based on recommendations made by the Commission for Agricultural Costs and Prices (CACP).
  • CACP projects three kinds of production cost (A2, FL and C2 ) for every crop at state and all-India average levels.
  • CACP considers both A2+FL and C2 costs while recommending MSP.
  • CACP reckons only A2+FL cost for determining MSP.(~1.5X (A2+FL))
    • However, C2 costs are used by CACP primarily as benchmark reference costs (opportunity costs) to see if the MSPs recommended by them at least cover these costs in some of the major producing States
• Timing of Announcement: The MSP is declared at the beginning of the sowing season to help farmers plan their cropping patterns.
• Crops Covered Under MSP:
  • Total Crops: MSP is recommended for 22 crops, along with a Fair and Remunerative Price (FRP) for sugarcane.
    • It’s important to note that for sugarcane, the FRP is determined by the Department of Food & Public Distribution.
  • Kharif Crops (14): Paddy, Bajra, Jowar, Maize, Arhar (Pigeon Pea), Ragi, Moong (Green Gram), Groundnut-in-shell, Urad (Black Gram), Soybean, Niger Seed, Sunflower, Sesamum, and Cotton.
  • Rabi Crops (6): Barley, Wheat, Gram, Rapeseed/Mustard Seed, Masur (Lentil), and Safflower.
  • Other Commercial Crops (2): Copra and Jute.
• Additional MSP Fixation:
  • The MSP for Toria is based on the MSP of rapeseed and mustard.
  • The MSP for de-husked coconut is derived from the MSP of copra.

Pro and Con of MSP as a Legal Right

Government Arguments Against MSP as a Legal Right

• WTO Limitations:  One of the primary concerns regarding MSP and its potential conflict with WTO regulations is the de minimis rule. 
  • This rule sets a limit on the level of domestic support that countries can provide to their agricultural sectors without triggering trade disputes.
  • India’s MSP program, particularly when implemented rigorously, could potentially exceed this de minimis limit. This could invite challenges from other WTO member countries, especially those that are major agricultural exporters.
  • Export Restrictions: To protect domestic markets and ensure MSP is effective, India might impose export restrictions on certain agricultural commodities. However, such measures can be challenged at the WTO as they can disrupt global trade.
  • India’s Stance: India has consistently argued that its agricultural policies, including MSP, are essential for food security and rural development.
    • It contends that these policies are necessary to protect its vulnerable farming community and maintain stable food supplies
• Existing Policies: The government argues that existing policies, such as MSP and procurement operations, already provide sufficient support to farmers.

Check Out UPSC Modules From PW Store

Global Practices of Market Intervention Mechanism

• Price Support Programs: Governments set a minimum price for agricultural products and purchase surplus production to maintain the price floor.
  • Example: The European Union’s Common Agricultural Policy (CAP) has historically used price support mechanisms to protect farmers’ incomes and ensure food security.
• Input Subsidies: Governments provide subsidies on agricultural inputs like fertilizers, pesticides, and seeds to reduce production costs for farmers.
  • Example: Many developing countries, including India and China, have implemented input subsidy programs to boost agricultural productivity and ensure food self-sufficiency.
• Export Subsidies: Governments provide subsidies to exporters to make their products more competitive in international markets.
  • Example: The United States has used export subsidies for agricultural products like cotton and wheat to support domestic producers and increase market share.
• Trade Restrictions: Governments impose tariffs, quotas, or other trade barriers to protect domestic producers from foreign competition.
  • Example: The United States has imposed tariffs on agricultural imports, such as sugar and dairy products, to protect domestic producers.

Land Acquisition Act 

• The Right to Fair Compensation and Transparency in Land Acquisition, Rehabilitation and Resettlement Act, 2013 replaced the archaic Land Acquisition Act of 1894.
• Key changes brought by the Land Acquisition, Rehabilitation and Resettlement Act, 2013:
  • Unlike the old Act, the new Act will provide for rehabilitation and resettlement of people displaced by land acquisition.
  • Consent: Earlier there was no requirement for prior consent. The new Act makes it necessary to obtain consent of 80% land owners required for private projects and 70% landowners required for Public-Private Partnership Projects.
  • Increasing the compensation value: Higher compensation of 4 and 2 times of market rate for land acquisition in rural and urban areas respectively.
  • SIA: The earlier Act did not take into account the impact of land acquisition on different sections of society.
    • This issue has been addressed by introducing social impact assessment (SIA) prior to land acquisition.
  • Restrictions on agricultural land: There is restriction on land acquisition of irrigated multi-cropped land. It addresses the issue of shrinking agricultural land.
  • Special safeguards for tribal communities are expected to solve the issue of tribal displacement.

DOWNLOAD PDF

The Ratapani Wildlife Sanctuary in Madhya Pradesh has officially been notified as a Tiger Reserve and NTCA has recently granted in-principle approval for declaring Madhav National Park as a Tiger Reserve. 

About Ratapani Tiger Reserve

• Location: Spread across Raisen and Sehore districts in Madhya Pradesh.
  • It forms a crucial part of the state’s tiger habitat and serves as a migration corridor for tigers from the Satpura ranges.
• Tiger Population: It is home to approximately 90 tigers.
• Threat in the reserve: Challenges of habitat encroachment and human-wildlife conflict.
  • Human-Wildlife Conflict:
    • Tigers frequently strayed into human settlements due to habitat degradation and insufficient prey.
    • Reports of tiger attacks and retaliatory killings by villagers highlighted the severity of the issue.
  • Habitat Degradation:
    • Encroachment and approval of infrastructure projects in buffer zones posed a threat to the ecosystem.
    • Projects like coal-based thermal power plants and railway lines were approved without assessing their impact on tiger habitats.
• Significance: It is now the eighth Tiger Reserve in Madhya Pradesh, further solidifying the state’s reputation as the “Tiger State of India.”

Enroll now for UPSC Online Classes

Process of Recognizing a Tiger Reserve

• Identification of Potential Areas:
  • Ecological Assessment: Identifying areas with suitable tiger habitat, prey base, and water sources.
  • Wildlife Surveys: Conducting regular wildlife surveys to assess tiger populations and their distribution.
  • Human-Wildlife Conflict Assessment: Evaluating the potential for conflict between humans and wildlife.
• Proposal Submission:
  • State Forest Department: The state forest department submits a proposal to the National Tiger Conservation Authority (NTCA).
  • Proposal Details: The proposal should include details such as the proposed area, core and buffer zones, management plan, and mitigation measures for human-wildlife conflict.
• NTCA Approval:
  • Technical Scrutiny: The NTCA’s technical committee reviews the proposal to assess its feasibility and compliance with the Wildlife Protection Act, 1972, and other relevant regulations.
  • In-Principle Approval: If the proposal is deemed suitable, the NTCA grants in-principle approval.
• Notification:
  • State Government Notification: The state government issues a formal notification declaring the area as a tiger reserve.
  • Gazette Notification: The notification is published in the official gazette to give it legal effect.

Challenges Faced in the Ratapani Case

• Bureaucratic Delays: The state government’s bureaucratic hurdles and lack of urgency hindered the notification process.
• Vested Interests: Mining activities and other human pressures in the region posed a threat to the tiger habitat.
• Human-Wildlife Conflict: Increasing human-wildlife conflict required effective mitigation measures.
• Lack of Adequate Prey Base: Ensuring a sufficient prey base for tigers was crucial for the long-term viability of the reserve.
• Role of Public Interest Litigation (PIL): The PIL filed against the delay played a significant role in accelerating the notification process. 
  • The High Court’s intervention highlighted the urgency of the issue and pressured the state government to take action.

Future Conservation Efforts

• Boundary Demarcation: Clearly defining core and buffer zones to prevent further encroachments.
• Anti-Poaching Measures: Strengthening anti-poaching patrols and enhancing surveillance in the reserve.
• Community Engagement: Collaborating with local communities to adopt wildlife-friendly practices.
  • Offering alternative livelihoods to reduce dependency on forest resources.
• Prey Base Restoration: Reintroducing herbivores and protecting vegetation to build a sustainable prey base for tigers.

Check Out UPSC NCERT Textbooks From PW Store

About Madhav National Park

• Location and Geography: Situated in the Shivpuri district, Madhya Pradesh, it encompasses an area of approximately 1,751 square kilometers.
• Flora: The park boasts dry deciduous forest, dominated by teak, sal, and mixed vegetation.
• Fauna: Notable wildlife includes
  • Mammals: Tigers, leopards, sambar, chital, nilgai, chinkara, and sloth bears.
  • Avifauna: Over 200 bird species, including migratory species during winter.
• Conservation Milestone: Successful tiger breeding program, leading to the birth of tiger cubs in September 2024, marking significant progress in tiger restoration.
• Tiger Reintroduction and Restoration Program: Tigers were reintroduced in 1990, with notable progress marked by the recent births of cubs, indicating a thriving environment.
• • Phase II of the program aims to introduce additional tigers from Bandhavgarh, Kanha, and Sanjay-Dubri National Parks.
• Long-term Expansion Plans: The park is set to grow into a sprawling 1,600 sq. km area over five years, focusing on habitat connectivity and prey base restoration.

DOWNLOAD PDF

The 13th edition of the National Seed Congress (NSC) concluded recently in Uttar Pradesh, bringing together over 700 participants, including scientists, policymakers, and industry leaders.

About National Seed Conference

• The National Seed Congress (NSC) is an annual event bringing together researchers, policymakers, farmers, and stakeholders from the public and private sectors.

• It serves as a platform to discuss advancements in seed production, crop improvement, and delivery systems to strengthen agriculture in India and globally.
• Jointly organized by the Union Agriculture Ministry and the International Rice Research Institute (IRRI).

Enroll now for UPSC Online Course

Objectives

• Promote Innovation: Encourage research and technological advancements in seed production and crop improvement.
• Facilitate Collaboration: Strengthen public-private partnerships and regional cooperation in the seed industry.
• Enhance Farmer Empowerment: Build capacities among farmers, seed entrepreneurs, and other stakeholders.Policy Development: Deliberate on frameworks and reforms, such as a new Seeds Bill, to regulate and improve the sector.
• Sustainable Agriculture: Address global challenges like climate change, malnutrition, and food security through sustainable practices.

NSC 2024 Theme: Innovating for a Sustainable Seed Ecosystem

• Sustainable Seed Ecosystem: As per Food and Agriculture Organisation(FAO) Sustainable Seed Ecosystem ensures farmers’ access to timely, affordable, and high-quality seeds of suitable crop varieties, essential for sustainable agriculture.
• Focuses on hybrid and biofortified crops to combat malnutrition and ensure food security. Climate-Resilient Practices: Highlights the need for stress-tolerant seed varieties to adapt to climate change.
  • Encourages practices like Direct Seeded Rice and zero tillage to reduce farming input costs.
• Accelerated Breeding Cycles: Focus on reducing breeding time to quickly bring innovative seeds to the market.
  • Implementation of cutting-edge breeding technologies to enhance crop resilience and yield.

Policy and Partnership Recommendations

• Policy Frameworks: The need for a comprehensive New Seeds Bill to regulate the seed industry and ensure quality standards.
  • Enhancing seed entrepreneurship to empower farmers as key stakeholders in seed production and distribution.
• Public-Private Partnerships (PPP): Collaboration between government bodies and private entities to promote sustainable seed production.
  • Initiatives to strengthen supply chains and ensure accessibility to quality seeds.
• Developing Seed Parks: Establishment of seed parks to facilitate research, development, and large-scale production of high-quality seeds.
  • Plans to make U.P. a hub for quality seed production, focusing on hybrids, biofortified crops, and vegetable seeds.
• Support for Farmers: Empowering farmers through access to better seeds to boost productivity and profitability.
  • Encouraging farmer-led seed entrepreneurship to improve self-reliance and economic growth.
• Global and Local Collaboration: The Congress underscored the importance of international partnerships in addressing agricultural challenges.
  • Efforts to integrate biofortified rice and hybrid seeds into existing systems reflect a step toward sustainable development.

Challenges in India’s Seed Ecosystem

• Seed Replacement Rate (SRR): SRR represents the proportion of crop area sown with certified seeds instead of farm-saved seeds.
  • India’s SRR is approximately 15–20% for most crops, though it reaches 100% for hybrid seeds.
• Monoculture Farming: Extensive cultivation of Bt cotton reduces biodiversity and increases pest vulnerability.
• Seed Market Monopoly: Dominance of multinational corporations (e.g., Bayer) limits access to locally adapted seeds.
• Other Issues:
  • Absence of updated legislation (e.g., pending Seed Bill).
  • Insufficient promotion of seed entrepreneurship.

Check Out UPSC CSE Books From PW Store

Government Initiative to Improve Seeds Availability

• National Seed Corporation (NSC): Established in 1963, it produces foundation and certified seeds for over 600 varieties across 60 crops.
• Seeds Act, 1966: Regulates seed quality and establishes State Seed Certification Agencies.
• National Seed Policy, 2002: Emphasizes varietal development, seed quality assurance, and intellectual property protection.
• Seed Village Programme (Beej Gram Yojana): Aims to improve the quality of seeds saved by farmers.
• National Seed Reserve: Maintains reserves to ensure seed availability during climatic disruptions or emergencies.

DOWNLOAD PDF

Recently the Government of India has scrapped the windfall tax on aviation turbine fuel (ATF), crude oil, petrol, and diesel.

Enroll now for UPSC Online Course

Key Highlight on Application and Withdrawal

• Introduction  of Windfall Tax in India: To address the shortage of energy products in the domestic market, the Indian government added a special additional excise duty on the export of gasoline and diesel, known as the Windfall Tax in July 2022.
• Reasons for Rollback:
  • Stabilized Oil Prices: Global crude oil prices have stabilized at around $70–$75 per barrel.
  • Revenue Decline: Government revenue from this tax dropped significantly from ₹25,000 crore in FY23 to ₹6,000 crore in FY25.
  • Industry Challenges: The levy impacted profitability, deterred investments, and created uncertainty for private and foreign players.
• Associated Measures: Withdrawal of the Road and Infrastructure Cess (RIC) on petrol and diesel exports.
  • Final tax revision on August 31, 2024, with export duties already at zero as of September 18, 2024.

Criticism of Windfall Tax

• Discouragement of Investment: Windfall taxes might discourage businesses from making investments in sectors that are susceptible to windfall gains..
• Uncertainty for Investors: Windfall taxes create uncertainty for investors, making it difficult for businesses to predict their potential returns and plan for the future.
• Discouraging Excessive Profiteering: These taxes can discourage businesses or industries from taking advantage of unforeseen circumstances to generate disproportionately high profits, promoting fair market behavior.
• Complex Implementation: Determining what constitutes a “windfall” and setting the appropriate tax rate can be challenging.

Check Out UPSC Modules From PW Store

Impact Of the Withdrawal

• Positive for Oil Industry:
  • Producers and Refiners: Companies like Reliance Industries and ONGC are expected to see improved refining margins and profitability.
  • Stock Market Response: Shares of Reliance Industries and ONGC have shown gains post-announcement.
• Potential Economic Boost: Removal of the levy could encourage increased crude oil production and refining capacity expansion.
  • Export competitiveness may rise, benefiting Indian manufacturers with stronger export order growth.
• Global Competitiveness: The rollback aligns with global oil price trends and ensures Indian producers remain competitive internationally.
• Government Revenue Adjustments: While this decision might reduce short-term revenue, it is likely a strategic move to bolster long-term economic growth by incentivizing production and investments.

DOWNLOAD PDF

The Centre for DNA Fingerprinting and Diagnostics (CDFD) in a DNA Analysis conducted on a family has revealed the practice of Levirate, raising questions about maintaining Genetic Privacy.

• The DNA profiles of the donor (father), the patient, and the patient’s mother were generated.
• The DNA showed that the woman’s husband was not the actual father of the patient but a close paternal relative, possibly a brother of the actual father suggesting the practice of Levirate.

About DNA Profiles

• A DNA profile is a set of genetic characteristics that are obtained from a person by analyzing their DNA markers.
• DNA Profiling: It is also known as DNA fingerprinting, is a scientific technique employed to identify individuals based on their unique genetic makeup.
• Discovery: A British geneticist Alec Jeffreys discovered that certain regions of DNA contained patterns that were unique to each individual in the 1980s

Enroll now for UPSC Online Classes

• Process of DNA Profiling:
  • Isolation: It is to  create lots of copies of DNA from a sample (using the polymerase chain reaction, PCR)
  • Fragmentation: Using an enzyme to break the DNA into short lengths
  • Separation: The DNA fragments are segregated by size using a technique called capillary gel electrophoresis (Passing an electric current across a layer of gel)
  • Comparison: Matching the pattern of fragments on the gel with other samples of DNA 
• Methods: 
  • Short Tandem Repeats (STR) Analysis: STRs are non-coding regions of DNA that contain repeats of the same nucleotide sequence therefore focusing on specific regions of DNA that contain short sequence repetitions.
    • Example:  GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence GATA is repeated six times. 
  • Polymerase Chain Reaction (PCR): PCR is a technique used to amplify specific regions of DNA, making it easier to analyse. It has proved indispensable in cases where only a small amount of DNA is available.
  • Single Nucleotide Polymorphism (SNP) Analysis: SNPs are variations at a single base pair in the DNA sequence. With millions of SNPs spread across the human genome, their analysis can provide a detailed DNA profile.
• Use Case:
• • Criminal Investigation and Forensics: DNA profiling plays a critical role in the field of forensic science. It is employed to link suspects to crime scenes.
    • DNA Profiling technique was first applied in a criminal case in 1986, marking the dawn of a new era in forensic science.
  • Determining Genetic History: DNA profiling offers a reliable and accurate method for  exploring ancestral lines in genealogical research and establishing biological relationships.
  • Genetics Based Treatment Routine: The use of DNA profiling helps in understanding a patient’s predisposition to certain diseases and providing treatments according to their genetic makeup, leading to more effective and personalised healthcare.
  • Wildlife and Conservation Genetics: In wildlife and conservation, DNA profiling helps track animal migration, monitor genetic diversity, and manage breeding of endangered species.

DNA Profiling and Privacy Concerns 

• Reveal Sensitive Information: DNA Profiling can reveal sensitive private information relating to ancestry, medical history etc. to 3rd parties without taking prior consent leading to a breach.
• Surveillance Tool: The Technique can be used by governments in suppressing and discriminating against every dissenting voice raising against it leading  to the annihilation of democratic values.
• Security: Lack of effecting laws and its enforcement regarding  DNA profiles can make them prone to leakage and misuse 
• Discrimination: DNA information could be used to discriminate against different sections of the society based on religion, caste, race, class and sex and health by those having a control of it.
• Data Collection: Direct-to-consumer genetic testing companies may collect and share non-DNA information about you. This information could be sold to data brokers, who may use it to set insurance rates or home loan interest rates. 
• Forensic use: Law enforcement agencies may retain DNA samples and profiles for law enforcement purposes, such as identifying criminals or missing persons.

Check Out UPSC NCERT Textbooks From PW Store

Legal Provisions Regarding DNA Profiling in India

• Code of Criminal Procedure (CrPC): 
  • Section 53: It allows DNA profiling of suspects at the request of an investigation agency. It also allows a police officer to seek the aid of a medical professional to conduct an inquiry. 
  • Section 53A: It specifically allows DNA profiling for rape suspects.
• Evidence Act, 1872: Sections 45-51 of the Indian Evidence Act determines the admissibility of expert testimony, including DNA evidence, in court. 
• The Criminal Procedure (Identification) Act, 2022: It is an Indian law that allows police to collect identifiable information from individuals for criminal investigations like to take measurements, collect fingerprints, footprints, biological samples, and behavioral attributes from arrested people, including convicts 
• The DNA Technology (Use and Application) Regulation Bill, 2018: The Bill was withdrawn from the Lok Sabha due to opposition on grounds of the accuracy of DNA technology, potential threats to individual privacy, and the possibility of abuse.
  • Objectives:
    • To set up a DNA profiling board as the regulatory body, one of the functions of which would be to provide accreditation to laboratories authorised to carry out DNA sample tests. 
    • DNA Data Banks : To create databases ie. DNA Data Banks for storing of DNA information collected from convicts and accused. This database could be indexed and searched for matching samples from crime scenes
    • To facilitate collection of DNA samples from the convicts and accused.

DOWNLOAD PDF

PRAGATI system

Context: Recently, a study done by Oxford University Study Praised India’s PRAGATI System for its fast-tracking projects

More on the news

• Study Title: “From Gridlock to Growth: How Leadership Enables India’s PRAGATI Ecosystem to Power Progress.”
• Authors: Soumitra Dutta and Mukul Pandya.
• Presentation: It was presented at a symposium by the Indian Institute of Management-Bangalore.

Enroll now for UPSC Online Course

About PRAGATI System

• PRAGATI  stands for Pro-Active Governance and Timely Implementation of projects.
• Launch Year: 2015.
• Implementing Agency: Prime Minister’s Office (PMO)
• Objective: Close monitoring and timely completion of infrastructure projects.
• Key Features of PRAGATI
  • Collaboration and Coordination
    • Brings together Central and State governments on a single platform.
    • Tackles challenges like land acquisition and inter-ministerial coordination effectively.
  • Technology-Driven Approach
    • Utilizes real-time data, drone feeds, and video conferencing to monitor projects.
    • Facilitates faster decision-making and problem-solving.
  • Accelerated Development: Helped fast-track 340 projects, improving services like roads, railways, water, and electricity.
• Economic Impact of  PRAGATI System
  • Multiplier Effect: According to studies by the RBI and the National Institute of Public Finance and Policy, every ₹1 spent on infrastructure generates ₹2.5 to ₹3.5 in GDP growth.
    • Highlights the role of infrastructure in boosting economic growth.
• Social Impact 
  • Essential Services: Projects related to roads, railways, water, and electricity have improved the living standards of millions of Indians. 
  • Sustainability: Incorporates environmental clearances and promotes green technologies.

Reclassification of packaged drinking water, mineral water

Context: Packaged drinking water and mineral water have been classified as high-risk food by the Food Safety and Standards Authority of India (FSSAI).

More on the news

• Purpose of the Reclassification
  • Strengthen Consumer Protection: Safeguard public health by ensuring safe and clean drinking water.
    • It implements stricter quality controls and improves consumer safety.
  • Ensure Rigorous Quality Control: Maintain stringent standards in the production of packaged water.
    • This move reflects the FSSAI’s commitment to enhancing food safety and protecting consumers.

Key Changes in Regulations

• Mandatory Annual Inspections
  • All facilities producing packaged drinking water must undergo annual inspections.
  • Applies specifically to central licence holders to reduce health risks.
• Third-Party Food Safety Audits
  • Manufacturers must now complete mandatory third-party audits to ensure compliance with food safety standards.
• Enhanced Quality Standards
  • Producers are required to adhere to higher quality benchmarks under the updated rules.
• Recent Regulatory Context
  • The reclassification follows amendments to the Food Safety and Standards (Prohibition and Restrictions on Sales) Regulations, 2011.
  • Earlier, mandatory BIS certification was removed for some food products, but stricter controls have now been introduced for packaged water.

Check Out UPSC CSE Books From PW Store

One-stop centres for Indian women

Context: The Ministry of Women and Child Development has approved a proposal by the Ministry of External Affairs to establish nine One-Stop Centres (OSCs).

Budget and Funding

• A dedicated budget line has been created by the Ministry of External Affairs for the initiative.
• Indian Community Welfare Fund (ICWF) will play a crucial role in funding welfare measures for distressed Indian nationals, particularly women.

About nine One-Stop Centres (OSCs)

• It is an initiative for the welfare of women. 
  • Under this initiative, the government addresses unique challenges faced by Indian women, particularly those abandoned or facing legal or financial difficulties.
• Locations of OSCs
  • With Shelter Homes: Seven OSCs to be set up in Bahrain, Kuwait, Oman, Qatar, UAE, and Saudi Arabia (Jeddah and Riyadh).
  • Without Shelter Homes: Two OSCs in Toronto and Singapore.

Exercise Agni Warrior (XAW-2024)

Context: The 13th edition of Exercise Agni Warrior (XAW-2024) highlights the deepening defense ties between India and Singapore concluded successfully on 30th November 2024 at Field Firing Ranges, Devlali, Maharashtra.

Enroll now for UPSC Online Classes

Key Highlights of XAW-2024

• Participating Contingents:
  • Singapore Armed Forces (SAF): 182 personnel from the Singapore Artillery.
  • Indian Army: 114 personnel from the Regiment of Artillery.
• Objectives:
  • Enhance mutual understanding of drills and procedures to achieve joint operational capability under the UN Charter.
  • Demonstrate joint firepower planning and execution, with a focus on New Generation Equipment.

DOWNLOAD PDF